mardi 13 janvier 2009

Année Darwin, 15 points forts de l'évolution et Mammouth

A l'occasion du bicentenaire de Darwin, Nature fait un dossier spécial sur le web

15 points forts de l'évolution

On y trouve un dossier disponible gratuitement (An), qui regroupe 15 articles qui mettent bien en évidence combien l'évolution est dynamique et solidement étayée.
Il y a les ancêtres terrestres de la baleine, les pinsons de Darwin, l'origine des plumes, etc.

...ça tombe bien pour ceux qui suivront la formation continue donnée par des spécialistes de l'Université de Genève !

Il y a aussi d'autres liens sur l'évolution :

Le mammouth séquencé !

On a pu séquencer la plus grande partie ( 70%) des 4 à 5 milliards de bases d'un mammouth (probablement 4.7, soit 1.4 fois le nôtre)
Les 2 spécimens de mammouth M4 et M25 étaient conservés dans le permafrost et on les a séquencé à partir de poils où l'ADN se conserve bien.
C'est un génome draft (d'une précision limitée : vers 1% d'erreurs) a pu observer qu'il n'est différent de l'éléphant d'afrique que de 0.6 %. Et les gènes sont similaires à environ 50 % avec ceux du Génome de Watson (Cf figure détaillée)

Figure 2 : les divergences estimées des mammouth et des humains dans leur groupes reespectifs.

Accéder directement en classe au Génome du Mammouth ?

Le génome complet est accessible au Mammoth genome project
On peut même y chercher une séquence (BLAST) et voir s'il a aussi une insuline !
Voir par exemple avec (AGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCG) qui est un fragment de l'insuline humaine: On y trouve effectivement une séquence qui correspond !

D'autres liens en anglais sont aussi disponibles :

Specials

See all specials

The 200th anniversary of the birth of Charles Robert Darwin falls on 12 February 2009. Darwin was arguably the most influential scientist of modern times. No single researcher has since matched his collective impact on the natural and social sciences; on politics, religions, and philosophy; on art and cultural relations, and in ways that the man himself would never have imagined. This Nature news special will provide continuously updated news, research and analysis on Darwin's life, his science and his legacy, as well as news from the Darwin200 consortium of organizations celebrating this landmark event.

Resources
- - 15 evolutionary gems - PDF (350KB)
  - We offer here 15 examples published by Nature over the past decade or so to illustrate the breadth, depth and power of evolutionary thinking. We are happy to offer this resource freely and encourage its free dissemination.
  - 31 December 2008
Editorial
- - Beyond the origin
  - As Nature anticipates next year's bicentenary of Darwin's birth and the 150th anniversary of On the Origin of Species, we begin our coverage with a look 50 years into the future.
  - 19 November 2008
News
- - The year of the worm?
  - The earthworm is finally inching its way into the genomic age.
  - 16 December 2008
News Features
- - The needs of the many
  - The idea that natural selection acts on groups, as well as individuals, is a source of unending debate. Marek Kohn reports on what the two sides disagree about — and why it matters to them.
  - 19 November 2008
- - Systems biology: Beneath the surface
  - Biologists see living systems like mechanical clocks: optimally tuned and prone to failure if one component goes wrong. But, as Tanguy Chouard reveals, this is not what happens in the real world.
  - 19 November 2008
- - Let's make a mammoth
  - Evolution assumes that extinction is forever. Maybe not. Henry Nicholls asks what it would take to bring the woolly mammoth back from the dead.
  - 19 November 2008

Slideshow
- - An eye for the eye
  - Darwin knew that the eye — so brilliantly 'designed' — might represent an obstacle to the acceptance of natural selection. We now know that the eye is one of evolution's crowning glories.
  - 19 November 2008
Commentary
- - Darwin 200: Great expectations
  - A new path for evolution? A truce in the culture wars? Here's what a selection of readers told Nature they expect from Darwin 200.
  - 19 November 2008
Essay
- - Birthdays to remember
  - Anniversaries of Charles Darwin's life and work have been used to rewrite and re-energize his theory of natural selection. Janet Browne tracks a century of Darwinian celebrations.
  - 19 November 2008
- - Darwin's enduring legacy
  - As the 200th year since the great naturalist's birth begins, Kevin Padian looks forward to a season of celebration by outlining how Darwin's ideas changed scientific thinking.
  - 7 February 2008
Podcast
- - The next 50 years
  - Listen to: Simon Ings and Gáspár Jékely on the evolving eye and Marek Kohn on group selection. Henry Nicholls and Stephan Schuster discuss making mammoths — and the online trade in mammoth hair. Presenters: Adam Rutherford and Charlotte Stoddart.
  - 19 November 2008
Letters
- - Sequencing the nuclear genome of the extinct woolly mammoth
  - A joint US/Russia team of 22 scientists describe what they did to sequence 80 per cent of the mammoth genome, 1000 years after extinction. Stephan Schuster and colleagues used hair from several different species found preserved in the permafrost.
  - 19 November 2008
- - Mechanism of phototaxis in marine zooplankton
  - Darwin suggested that the eye as we know it today, would have been preceded by a 'proto-eye'. Marine plankton can sense the direction of light using what are called 'eyespots' containing just two cells. Gáspár Jákely and colleagues from Germany believe they this simple mechanism for sensing light provides clues to what a proto-eye might have looked like.
  - 19 November 2008
News & Views
- - DNA sequencing: Mammoth genomics
  - The mammoth genome project was finished in a matter of months rather than years, thanks to new sequencing technology, says Michael Hofreiter.
  - 19 November 2008
Darwin200 consortium
- - Darwin200 is a programme of UK and international events celebrating Charles Darwin's scientific ideas — including exhibitions, debates, hands-on science, the latest news and more.
    www.darwin200.org